View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_high_20 (Length: 228)
Name: NF6569_high_20
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_high_20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 52402628 - 52402838
Alignment:
| Q |
18 |
gaggtttcaataaattttcttccttattatggctaattggattaatgaaaaagaatgagatggagcttaatagtgaaacaaagtctaatttcattcgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52402628 |
gaggtttcaataaattttcttccttattatggctaattggattaatgaaaaagaatgagatggagcttaatagtgagacaaagtctaatttcattcgttt |
52402727 |
T |
|
| Q |
118 |
gtgagaaatgatctataacttatttgcaattatattggccctatcaataataagattgtaagattttttgcatagaatgggttagacacactggaaaaca |
217 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52402728 |
gtgagaaatgatctataacttctttgcaattatattggccctatcaataataagattgtaagattttttgcatagaatgggttagacacaccggaaaaca |
52402827 |
T |
|
| Q |
218 |
agccttatcta |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
52402828 |
agccttatcta |
52402838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University