View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_high_21 (Length: 228)
Name: NF6569_high_21
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 2 - 188
Target Start/End: Complemental strand, 26655128 - 26654942
Alignment:
| Q |
2 |
catcaatcataggatataatatatgaaaaatgttaacttctacattaagaatgtctacaatggagcccttcttctaaagtgcatcatgctaaatagatac |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26655128 |
catcaatcataggatataatatatgaaaaatgttaacttctgcattaagaatgtctacaatggagcccttcttctaaagtgcatcatgctaaatagatac |
26655029 |
T |
 |
| Q |
102 |
ccttataatatcaataatttaggttcctatagagatggatgattatataagctctctctatcttatttatgtatgggtcacacatgc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26655028 |
ccttataatatcaataatttaggttcctatagagatggatgattatataagctctctctatcttatttatgtatgggtcacacatgc |
26654942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 200 - 228
Target Start/End: Complemental strand, 26654917 - 26654889
Alignment:
| Q |
200 |
ttattcaattgctatatagttttgttatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26654917 |
ttattcaattgctatatagttttgttatt |
26654889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University