View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_high_22 (Length: 226)
Name: NF6569_high_22
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 203
Target Start/End: Original strand, 51804643 - 51804834
Alignment:
| Q |
12 |
catcatcacacataaaccaggattccctgcaaagctttcaactaaccctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804643 |
catcatcacacataaaccaggattccctgcaaagctttcaactaaccctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaaag |
51804742 |
T |
|
| Q |
112 |
tttatagaattaggcaacaacacagagaggctttcagggatgtttccggttaagagattactggaaagatctagaaggttgagtgattccaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51804743 |
tttatagaattaggcaacaacacagagaggctttcagggatgtttccggttaagagattactggaaagatctagaaggttgagtgattccaa |
51804834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 58 - 195
Target Start/End: Complemental strand, 20018036 - 20017900
Alignment:
| Q |
58 |
cctcctttaatcaatttaggaggaataggaccagaaagaagattgtgtgaaaagtttatagaattaggcaacaacacagagaggctttcagggatgtttc |
157 |
Q |
| |
|
|||||||| |||||||| |||||||| ||| |||||| ||| | |||||| | ||| | ||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
20018036 |
cctcctttgatcaattttggaggaattggaacagaaaaaaggtagtgtgata-gttaacggaattagacaacgacacagagaggcttttggggatgttct |
20017938 |
T |
|
| Q |
158 |
cggttaagagattactggaaagatctagaaggttgagt |
195 |
Q |
| |
|
| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
20017937 |
cagttaagagattgttggaaagatcaagaaggttgagt |
20017900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University