View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_low_10 (Length: 395)
Name: NF6569_low_10
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 21 - 385
Target Start/End: Complemental strand, 37054804 - 37054440
Alignment:
| Q |
21 |
gtgcaccaccacatgtcggactccagactcgccttcaatgcaaaatgtcggtactacannnnnnnagcccgactgaaggggagaaaataatcaaaaaatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
37054804 |
gtgcaccaccacatgtcggactccagactcgccttcaatgcaaaatgtcggtactacatttttttagcccgactgaaggagagaaaataatcaaaaaatg |
37054705 |
T |
 |
| Q |
121 |
agagactgctatgaagttatcactttgtgagctagctactctactgaagagttgggattgttgattttagggcttccattggtattgttacttgatgtaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054704 |
agagactgctatgaagttatcactttgtgagctagctactctactgaagagttgggattgttgattttagggcttccattggtattgttacttgatgtaa |
37054605 |
T |
 |
| Q |
221 |
cattgccattactgttattagctattgtaccgttaccattattgctagtaccgttgttattgtttggctgcgccgccccaataattgaagtaatagcagc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054604 |
cattgccattactgttattagctattgtaccgttaccattattgctagtaccgttgttattgtttggctgcgccgccccaataattgaagtaatagcagc |
37054505 |
T |
 |
| Q |
321 |
tgctaaagctgcagtgaagttaggatcagctgcaatagcattaactgtgtcagcaaggttctgtg |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37054504 |
tgctaaagctgcagtgaagttaggatcagctgcaatagcattaactgtgtcagcaaggttctgtg |
37054440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University