View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_low_20 (Length: 239)
Name: NF6569_low_20
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 220
Target Start/End: Original strand, 52403045 - 52403255
Alignment:
| Q |
10 |
tcccctctactggctttgttattgatgatttatgcttaatgtatatccacttggtgataataacatataggtgaatgttattatgttaacatggaccact |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52403045 |
tcccctctcctggctttgttattgatgatttatgcttaatgtatatccacttggtgataataacatataggtgaatgttattatgttaacatggagcact |
52403144 |
T |
 |
| Q |
110 |
attaggtttgtccatggttgatcaacccactattgacgattatatcaagtaggacctctgagtctgttacacaattttttattttgtaaacactggttgg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52403145 |
attaggtttgtccatggttgatcaacccactattgacgattatatcaagtaggacctctgaatctgttacacaattttttattttgtaaacactggttgg |
52403244 |
T |
 |
| Q |
210 |
ttctggttcag |
220 |
Q |
| |
|
|||| |||||| |
|
|
| T |
52403245 |
ttctagttcag |
52403255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University