View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_low_21 (Length: 238)
Name: NF6569_low_21
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 61 - 221
Target Start/End: Complemental strand, 42409461 - 42409300
Alignment:
| Q |
61 |
gatagaactaataaattctatatattatctatatcatcaaattgaacnnnnnnnn-gcctaaaaattgaataattttagtattagatacctcaatttctc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42409461 |
gatagaactaataaattctatatattatctatatcataaaattgaacaaaaaaaaagcctaaaaattgaataattttagtattagatacctcaatttctc |
42409362 |
T |
 |
| Q |
160 |
taatctcgtactggtcccttataattagaactttgaaattgacagtctcaaggtccggaact |
221 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42409361 |
taatctcgtactggtcccttatagttagaactttgaaattgacagtctcaaggtccggaact |
42409300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University