View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_low_22 (Length: 238)
Name: NF6569_low_22
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_low_22 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 42410182 - 42409945
Alignment:
| Q |
1 |
agaacctctgaaatcaaacccactcttcccaggcattgtagtctcggctacaaagtaaggctgcaaagacaatcaagtcaacaagctggatgagattgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410182 |
agaacctctgaaatcaaacccactcttcccaggcattgtagtctcggctacaaagtaaggctgcaaagacaatcaagtcaacaagctggatgagattgct |
42410083 |
T |
|
| Q |
101 |
agaaactaactggtattattacaaaatataggaataaattttctcgattacaaacagcaacacaactttgagggtctttccacatccaaatgtgccaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410082 |
agaaactaactggtattattacaaaatataggaataaattttctcgattacaaacagcaacacaactttgagggtctttccacatccaaatgtgccaaaa |
42409983 |
T |
|
| Q |
201 |
gaccctaaataacttcaataagaacacaatcccctctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
42409982 |
gaccctaaataacttcaataagaacacgatctcctctc |
42409945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University