View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6569_low_27 (Length: 224)
Name: NF6569_low_27
Description: NF6569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6569_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 20 - 201
Target Start/End: Complemental strand, 3822416 - 3822235
Alignment:
| Q |
20 |
aatgtcaatatagtaactccagtttcaatgatgatccttttggtctggatcattgctctcttgggctttctcaaagttgctgcttcattgttgcgtcgcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822416 |
aatgtcaatatagtaactccagtttcaatgatgatccttttggtctggatcattgctctcttgggctttctcaaagttgctgcttcattgttgcgtcgcg |
3822317 |
T |
 |
| Q |
120 |
gtcaagagagacgtgatcgggcgggtcttattcctgaggatgaggtactaataaacttttatgagttttaacatcttagaat |
201 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3822316 |
gtcaagagagacgtgatggggcgggtcttattcctgaggttgaggtactaataaacttttatgagttttaacatcttagaat |
3822235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 4027433 - 4027393
Alignment:
| Q |
166 |
actaataaacttttatgagttttaacatcttagaattgcct |
206 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
4027433 |
actaataagcttttatgagttttaacaacttagaattgcct |
4027393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 85
Target Start/End: Original strand, 27416605 - 27416644
Alignment:
| Q |
46 |
aatgatgatccttttggtctggatcattgctctcttgggc |
85 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27416605 |
aatgatgatccttttgggctggatcattgctctcttgggc |
27416644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University