View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6571_high_21 (Length: 239)
Name: NF6571_high_21
Description: NF6571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6571_high_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 26523467 - 26523243
Alignment:
| Q |
17 |
aacaattatagggtatagtgtctatttattatgaggattgttacgacgtggttactaggaaacaagacatgcagtcaattgtagtacttgtaag-----t |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
26523467 |
aacaattatagggtatagtgtttatttat---gaggattgttacgacgtggttactaggaaacaagacatgcagtcaattgtagtacttgtaagatgtgt |
26523371 |
T |
|
| Q |
112 |
tgtgtggtgagtgagacccggttctggttatgattctggtgtcactgttgtggtatggtgtggttctgcctcttttgtcgtgactatggagcaagcaaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26523370 |
tgtgtggtgagtgagacccggttctggttatgattctggtgtcactgttgtggtatggtgtggttctgcctcttttgtcgtgactatggagcaagcaaag |
26523271 |
T |
|
| Q |
212 |
ggctggttttcactatgctactagtggc |
239 |
Q |
| |
|
|||||||||||||| | |||||||||| |
|
|
| T |
26523270 |
ggctggttttcacttttttactagtggc |
26523243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University