View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6571_low_11 (Length: 357)
Name: NF6571_low_11
Description: NF6571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6571_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 22 - 341
Target Start/End: Complemental strand, 47123703 - 47123384
Alignment:
| Q |
22 |
gtgttacttcggtgaaggtttatctttttattctttgtactgaaattttatctgttttattacactaggctcaactgcagagcattatccatggagtcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123703 |
gtgttacttcggtgaaggtttatctttttattctttgtactgaaattttatctgttttattacactaggctcaactgcagagcattatccatggagtcaa |
47123604 |
T |
|
| Q |
122 |
tgtgtgtcatgaagctaaataattgacatgtcttcttggtttggccatttagtgtggaatgttggtgaaaattgggtctatgaatgtgctacaatctttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47123603 |
tgtgtgtcatgaagctaaataattgacatgtcttcttggtttggccatttagtttggaatgttggtgaaaattgggtatatgaatgtgctacaatctttt |
47123504 |
T |
|
| Q |
222 |
atggcgagtattgagaaattttgagtaggcnnnnnnncatggcatgtgaacatcttgattcttgacggtacaaaattggtatcttcttgcatgatcttgt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123503 |
atggcgagtattgagaaattttgagtaggctttttttcatggcatgcgaacatcttgattcttgacggtacaaaattggtatcttcttgcatgatcttgt |
47123404 |
T |
|
| Q |
322 |
ggagtctttggagaagaaga |
341 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47123403 |
ggagtctttggagaagaaga |
47123384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University