View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6571_low_17 (Length: 290)
Name: NF6571_low_17
Description: NF6571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6571_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 13 - 287
Target Start/End: Complemental strand, 47123979 - 47123705
Alignment:
| Q |
13 |
attctgtcaaagagtcccgcaaacagaccacgtgttctcctcaagtgtatttttgaagagcagtgtggttttattgcagttcggtcgattctaaacaatg |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123979 |
attctttcaaagagtcccgcaaacagaccacgtgttctcttcaagtgtatttttgaagagcagtgtggttttattgcagttcggtcgattctaaacaatg |
47123880 |
T |
|
| Q |
113 |
tcttgatagctttagaggttgtccgtttcttgaaattcaaaactcgaggaaagttttaggaagttgctctaaaattgatattaataatagcaaagcttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123879 |
tcttgatagctttagaggttgtccgtttcttgaaattcaaaactcgaggaaagttttaggaagttgctctaaaattgatattaataatagcaaagcttat |
47123780 |
T |
|
| Q |
213 |
gtagattggagatatctcttcactatcttggaagaaaagggttttaaacaaaaatggataggctcgatgcggact |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123779 |
gtagattggagatatctcttcactatcttggaagaaaagggttttaaacaaaaatggataggctcgatgcggact |
47123705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University