View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6571_low_23 (Length: 225)
Name: NF6571_low_23
Description: NF6571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6571_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 10427012 - 10427213
Alignment:
| Q |
1 |
tatggggttcaatgcaaaggacatagtgtataattctgttctttcatttttcaatcaagttctatgaaacaaatttaatgctatatatgtactaggttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10427012 |
tatggggttcaatgcaaaggacatagtgtataattctgttctttcatttttcaatcaagttctatgaaacaaatttaatgctat----gtactaggttgc |
10427107 |
T |
 |
| Q |
101 |
cactggtatcaatatatgttattattatttatgtagtgaagattaacttatgcattagcattacacaaaatgaagtagcttagttgatttatttcgtgtt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10427108 |
cactggtatcaatatatgttagtattatttatgtagtgcagattaacttatgcattagcattacacaaaatgaagtagcttagtttatttatttcgtgtt |
10427207 |
T |
 |
| Q |
201 |
gttaat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
10427208 |
gttaat |
10427213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 154
Target Start/End: Original strand, 10429441 - 10429506
Alignment:
| Q |
86 |
tatgtactaggttgccactggtatcaatatatgttattattatttatgtagtgaagattaacttatgca |
154 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| ||||||||||| | || |||||||||||||||| |
|
|
| T |
10429441 |
tatgtactaggttgtcactggtatcagaatatg---ttattatttatctggtaaagattaacttatgca |
10429506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University