View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6574_high_11 (Length: 258)

Name: NF6574_high_11

Description: NF6574

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF6574_high_11

[»] chr3 (2 HSPs)

Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)

Name: chr3

Description:

Target: chr3; HSP #1

Raw Score: 143; E-Value: 3e-75

Query Start/End: Original strand, 15 - 207

Target Start/End: Original strand, 50484390 - 50484583

Alignment:

Q	15	tattaaacttcgatgaatatttacaaaatgaaaa-tgatcactatgctagttggttaacctacaannnnnnnnnnnnngaaggcacctacagatttatca	113	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	50484390	tattaaacttcgatgaatatttacaaaatgaaaaatcatcactatgctagttggttaacctacaattttttgttttttgaaggcacctacagatttatca	50484489	T

Q	114	gatagtacttttatcaatttaaaaaattgaaacatcatatcgttgcttttagaggataattttagttcattaatatttttctgtaatttagact	207	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	50484490	gatagtacttttatcaatttaaaaaattgaaacatcatatcgttgcttttagaggataattttagttcattaatatttttctgtaatttagact	50484583	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2

Raw Score: 30; E-Value: 0.00000009

Query Start/End: Original strand, 229 - 258

Target Start/End: Original strand, 50484605 - 50484634

Alignment:

Q	229	tttcatacatttcaaactaaacaaattgct	258	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	50484605	tttcatacatttcaaactaaacaaattgct	50484634	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]