View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6574_high_12 (Length: 251)
Name: NF6574_high_12
Description: NF6574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6574_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 35472448 - 35472686
Alignment:
| Q |
1 |
tcttcacaactcatgttttcggcgaaccaactgttttttcagctgacccggaaacgaaccggtttattttaatgaatgaagggaaactttttgaatgtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35472448 |
tcttcacaactcatgttttcggcgaaccaactgttttttcagctgacccggaaacgaaccggtttattttaatgaatgaagggaaactttttgaatgtag |
35472547 |
T |
|
| Q |
101 |
ttaccccggttcaatatcgaaccttttgggaaaacactctttgcttcttatgaaaggttctcttcataagagaatgcattcgcttactatgagttttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35472548 |
ttaccccggttcaatatcgaaccttttgggaaaacactctttgcttcttatgaaaggttctcttcataagagaatgcattcgcttactatgagttttgct |
35472647 |
T |
|
| Q |
201 |
aactcctcaattattaaggatcatcttcttcttgatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35472648 |
aactcctcaattattaaggatcatcttcttcttgatatt |
35472686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 31551765 - 31551992
Alignment:
| Q |
11 |
tcatgttttcggcgaaccaactgttttttcagctgacccggaaacgaaccggtttattttaatgaatgaagggaaactttttgaatgtagttaccccggt |
110 |
Q |
| |
|
||||||||| || ||||| || ||||| || |||||||||||||| ||||| |||||| | |||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
31551765 |
tcatgtttttggtgaaccgacagttttctctgctgacccggaaacaaaccgatttattattatgaatgaagggaagctttttgaatgtagctaccccggt |
31551864 |
T |
|
| Q |
111 |
tcaatatcgaaccttttgggaaaacactctttgcttcttatgaaaggttctcttcataagagaatgcattcgcttactatgagttttgctaactcctcaa |
210 |
Q |
| |
|
|||||||| |||||| | |||||||| || |||||||||||||| ||||||||||| |||| ||||||||| || ||||||||||||||||| || || | |
|
|
| T |
31551865 |
tcaatatcaaaccttcttggaaaacattcattgcttcttatgaagggttctcttcacaagaaaatgcattctctcactatgagttttgctaattcgtcta |
31551964 |
T |
|
| Q |
211 |
ttattaaggatcatcttcttcttgatat |
238 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
31551965 |
ttattaaggatcatcttctctttgatat |
31551992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University