View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6574_low_12 (Length: 274)
Name: NF6574_low_12
Description: NF6574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6574_low_12 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 58 - 274
Target Start/End: Original strand, 35472172 - 35472388
Alignment:
| Q |
58 |
ccaacataacattcacatatagtacaacacaagttactacaacttctccttcnnnnnnnngttactacaactttctcatggcaactatactcttctttgt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35472172 |
ccaacataacattcacatatagtacaacacaagttactacaacttctccttcaaaaaaaagttactacaactttctcatggcaactatactcttctttgt |
35472271 |
T |
|
| Q |
158 |
tatcatcttcaccatcttttttctcattcaccggagtactcaccggcggcgatacaagctcccaccggggagtcttggactaccctttgtaggagaaact |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35472272 |
tatcatcttcaccatcttttttctcattcaccggagtactcaccggcggcgatacaagctcccaccggggagtcttggactaccctttgtaggggaaact |
35472371 |
T |
|
| Q |
258 |
atgcaactaatatcagc |
274 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
35472372 |
atgcaactaatatcagc |
35472388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University