View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6574_low_13 (Length: 258)
Name: NF6574_low_13
Description: NF6574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6574_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 15 - 207
Target Start/End: Original strand, 50484390 - 50484583
Alignment:
| Q |
15 |
tattaaacttcgatgaatatttacaaaatgaaaa-tgatcactatgctagttggttaacctacaannnnnnnnnnnnngaaggcacctacagatttatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50484390 |
tattaaacttcgatgaatatttacaaaatgaaaaatcatcactatgctagttggttaacctacaattttttgttttttgaaggcacctacagatttatca |
50484489 |
T |
 |
| Q |
114 |
gatagtacttttatcaatttaaaaaattgaaacatcatatcgttgcttttagaggataattttagttcattaatatttttctgtaatttagact |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50484490 |
gatagtacttttatcaatttaaaaaattgaaacatcatatcgttgcttttagaggataattttagttcattaatatttttctgtaatttagact |
50484583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 229 - 258
Target Start/End: Original strand, 50484605 - 50484634
Alignment:
| Q |
229 |
tttcatacatttcaaactaaacaaattgct |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50484605 |
tttcatacatttcaaactaaacaaattgct |
50484634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University