View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6577_high_31 (Length: 218)
Name: NF6577_high_31
Description: NF6577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6577_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 42581879 - 42581697
Alignment:
| Q |
14 |
cagagacggtgaagtacctggcgagaacagataagcgaggtgtccaaggagcaggagtgccggtgggaggacggttagggatggcggtgtcgttgaatga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42581879 |
cagagacggtgaagtacctggcgagaacagataagcgaggtgtccaaggagcgggagtgccggtgggaggacggttagggatggcggtgtcgttgaatga |
42581780 |
T |
 |
| Q |
114 |
ggttcgtcggagcggtgaaggagttaccggagaatcggatagtgtgggaggagtgcgaggattgttcttcttcttcttcggtc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42581779 |
ggttcgtcggagcggtgaaggagttaccggagaatcggatagtgtgggaggagtgcgaggattgttcttcttcttcttcggtc |
42581697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University