View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6577_low_13 (Length: 332)
Name: NF6577_low_13
Description: NF6577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6577_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 326
Target Start/End: Complemental strand, 7108578 - 7108253
Alignment:
| Q |
1 |
ttgttcttatatggtttgccattttcattgttaaaagatttggagagaagcattaggaacttcatttggagtggggacattgagaagaggaaattagtca |
100 |
Q |
| |
|
|||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108578 |
ttgtccttatatgctttgctattttcattgttaaaagatttggagagaagcattaggaacttcatttggagtggggacattgagaagaggaaattagtca |
7108479 |
T |
|
| Q |
101 |
ttgtggcatggaaaaaatttgtaagccattagaggagggagggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttga |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108478 |
ttgtggcatgaaaaaaatttgtaagccattagaggaaggagggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgg |
7108379 |
T |
|
| Q |
201 |
gagaatggcgtcttctgatacggatcgggcaaagatgttaaggtctagagttttaaaaaacgatagatgtatttcttatcatattttctcctctttatcg |
300 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108378 |
gagaatggcgtcttctgatacggattgggcaaagatgttaaggtctagagttttaaaaaatgatagatgtatttcttatcatattttctcctctttatcg |
7108279 |
T |
|
| Q |
301 |
agtagttttaaaagtgagtataatct |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7108278 |
agtagttttaaaagtgagtataatct |
7108253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University