View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6577_low_25 (Length: 251)
Name: NF6577_low_25
Description: NF6577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6577_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 32099711 - 32099487
Alignment:
| Q |
18 |
cacttagttaattaatagatgatcacaatatatatgtatgtactaaattataannnnnnnnn--gggtgactatggctccggcaatcaaatgtagtattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32099711 |
cacttagttaattaatagatgatcacaatatatatgtatgtactaaattataatttttttttttgggtgactatggctccggcaatcagatgtagtattt |
32099612 |
T |
 |
| Q |
116 |
tcccaacatagtggcagccatgcagaatatatagtagtttattgaaagctgtcaaatataatttatcaaatgtgttgccttgaacaattccaattagcga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32099611 |
tcccaacatagtggcagccatgcagaatatatagtagtttattgaaagctgtcaaatataatttatcaaatgtgttgccttgaacaattcctattagcga |
32099512 |
T |
 |
| Q |
216 |
ctagcgtaaccttctgtctcccttt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32099511 |
ctagcgtaaccttctgtctcccttt |
32099487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University