View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6577_low_28 (Length: 239)
Name: NF6577_low_28
Description: NF6577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6577_low_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 23 - 239
Target Start/End: Original strand, 46302704 - 46302921
Alignment:
| Q |
23 |
tgtgtccaacctaataatatcaacatcatcagttaaattgactctacttaaaaaagggaaatttttaatttaggattttcttaactaatgtagttttaaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46302704 |
tgtgtccaacctaataatatcaacatcatcagttaaattgactctacttaaaaaaggaaaatttgtaatttaggattttcttaactaatgtagttttaaa |
46302803 |
T |
 |
| Q |
123 |
cagtttttt-atacgtgtctcttgatttgacaccccgtcgctcttcaggttcagaatgatgtcattaacagcaatgtctatatagtttactgcaattaga |
221 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46302804 |
cagttttttgatatgtgtctcttgatttgacaccccgtcgctcttcaggttcagaatgatgtcattaacagcaatgtctatatagtttactgcaattaga |
46302903 |
T |
 |
| Q |
222 |
attttatagtgtaatttt |
239 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46302904 |
attttatagtgtaatttt |
46302921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University