View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6577_low_33 (Length: 218)

Name: NF6577_low_33
Description: NF6577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6577_low_33
NF6577_low_33
[»] chr5 (1 HSPs)
chr5 (14-196)||(42581697-42581879)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 14 - 196
Target Start/End: Complemental strand, 42581879 - 42581697
Alignment:
14 cagagacggtgaagtacctggcgagaacagataagcgaggtgtccaaggagcaggagtgccggtgggaggacggttagggatggcggtgtcgttgaatga 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
42581879 cagagacggtgaagtacctggcgagaacagataagcgaggtgtccaaggagcgggagtgccggtgggaggacggttagggatggcggtgtcgttgaatga 42581780  T
114 ggttcgtcggagcggtgaaggagttaccggagaatcggatagtgtgggaggagtgcgaggattgttcttcttcttcttcggtc 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42581779 ggttcgtcggagcggtgaaggagttaccggagaatcggatagtgtgggaggagtgcgaggattgttcttcttcttcttcggtc 42581697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University