View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6577_low_9 (Length: 394)
Name: NF6577_low_9
Description: NF6577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6577_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 392
Target Start/End: Original strand, 2384717 - 2385108
Alignment:
| Q |
1 |
ttcccattgttctcatattcttcggaacttcaccgtaaaagaattcttgcataccaaccactgtgaaaatatctgatataccaagaagaatgtactgtgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2384717 |
ttcccattgttctcatattcttcggaacttcaccgtagaaaaattcttgcataccaaccactgtgaaaatatccgatataccaagaagaatgtactgtgg |
2384816 |
T |
 |
| Q |
101 |
aagcaaccagaaaatgcttattggtactatttctgatagtaatccttcacttctcatttgtcgaccgatggcaaggcgtttcatttcaactagagctgcg |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
2384817 |
tagtaaccagaaaatgcttattggtactatttctgatagtaatccttcacttctcatttgtcgaccgatagcaagacgtttcatttcaactagtgctgcg |
2384916 |
T |
 |
| Q |
201 |
ataatcatcgctatgattgagagaaccattccgattcccatcctttgcatcacgttgatacctttttcttgtcgtgttatcagttgagcaaacggtatga |
300 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| || ||||||||||| |||||||||||||| || || |||||||||| |
|
|
| T |
2384917 |
ataatcatcgctatgattgagagtaccattccgattcccattctttgcatcacatttatacctttttcctgtcgtgttatcagctgcgcgaacggtatga |
2385016 |
T |
 |
| Q |
301 |
aaattctgtcgtataacggcatcaatagtataatggacaaggttatagcactttggagtgtggcgggtggtatcttgaaatttgaacctatg |
392 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2385017 |
aaattctgttgtataacggcatcaatagtattatagacaatgttatagcactttggagtgtggcgggtggtatcttgaaatttgaacctatg |
2385108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University