View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6578_high_7 (Length: 216)
Name: NF6578_high_7
Description: NF6578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6578_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 15 - 200
Target Start/End: Complemental strand, 46957454 - 46957269
Alignment:
| Q |
15 |
aagaagaacagattatagaatatagttggtgatgataccatgtggagtagtaattaacatagcttcctttcttggcaatgaacaaggcaacattatacgc |
114 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46957454 |
aagaggaacagattatagaatatagatagtgatgataccatgtggagtagtaattaacatagcttcctttcttggcaatgaacaagggaacattatacgc |
46957355 |
T |
|
| Q |
115 |
aatgtctttagctgatctcaagtatgacactccaccaaaggcttgataacttcaaattaatttaaacatcagataatggcattagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46957354 |
aatgtctttagctgatctcaagtatgacactccaccaaaggcttgataacttcaaattaatttaaacatcagataatggcattagt |
46957269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 65 - 159
Target Start/End: Complemental strand, 40100985 - 40100891
Alignment:
| Q |
65 |
taattaacatagcttcctttcttggcaatgaacaaggcaacattatacgcaatgtctttagctgatctcaagtatgacactccaccaaaggcttg |
159 |
Q |
| |
|
||||| ||||| ||||||||||| || |||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
40100985 |
taattgacataacttcctttctttgctatgaacaaggcaacattataggcaatgtctgaagctgatctcatgtatggtgctccaccaaaagcttg |
40100891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University