View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6578_low_1 (Length: 415)
Name: NF6578_low_1
Description: NF6578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6578_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 8 - 351
Target Start/End: Complemental strand, 18644781 - 18644440
Alignment:
| Q |
8 |
ccaagaatatcgaaccaagcgctgcaacacacagaaaaacaaagatcattatgattcttctacgttctaacattgtgaatgaagttgatttggtagataa |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||| |||||||| |||| |||| | |
|
|
| T |
18644781 |
ccaaaaatatcgaaccaagcgctgcaacacacagaaaaacaaagaccatcatgattcttctacgttctaatatggtgaacgaagttgagttggaagatga |
18644682 |
T |
 |
| Q |
108 |
agttgttgttccgttcataaggtgtgcctggacgttgttgtcaacagtgttggctaacgttcgtctgaatagagtgttggccattggatctcgtaaattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18644681 |
agttgttgttccgttcataaggtgtgcctggacgttgttgtcaacagtgttggctaacgttcgtctgaatag--tgttggccattggatctcgtaaattt |
18644584 |
T |
 |
| Q |
208 |
aaggtagtaaaacacaatagtttatttgtcactccggttggagtgttgtatctaaaaacaccctaacgatgatcaagtaaaatgtgtcgaatatgtaagg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18644583 |
aaggtagtaaaacacaatagtttatttgtcactccggttggagtgttgtatctaaaaacaccctaacgatgatcaagtaaaatgtgtcgaatatgtaagg |
18644484 |
T |
 |
| Q |
308 |
ttttaggaataaaaaagtgtgttaggaacggtgtcttgagaggt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18644483 |
ttttaggaataaaaaagtgtgttaggaacggtgtcttgagaggt |
18644440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 355 - 397
Target Start/End: Complemental strand, 18644131 - 18644089
Alignment:
| Q |
355 |
cacagtcttaacaagaacaaaagtgccgctttcgtctctaata |
397 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18644131 |
cacagtcttaacaagaacaaaagtgccgccttcgtctctaata |
18644089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University