View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_high_24 (Length: 305)
Name: NF6579_high_24
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 5 - 289
Target Start/End: Original strand, 43621877 - 43622158
Alignment:
| Q |
5 |
ccttcttcttagcgctcctacttaggtacacatcatattattatacccttccattttattcaattatagcttattgaacgcttttccattcttatctctt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43621877 |
ccttcttcttagcgctcctacttaggtacacatcatatt---atacccttccattttattcaattatagcttattgaacgcttttccattcttatctttt |
43621973 |
T |
 |
| Q |
105 |
gtcaaaactaactttgattgattttgattccagttttgagctattgcacatttcttaattaatttatatgaataatttagattcggaccgcaccacccct |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43621974 |
gtcaaaactaactttgattgattttgattccagttttgagcttttgcacatttcttaattaatttatatgaataatttagattcggaccgcaccacccct |
43622073 |
T |
 |
| Q |
205 |
cttgttttaataccaactagaaaaatcatgaatcatatgttgttttactatgtatagatcatgaatgaaaatgtgtcgcatttgt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43622074 |
cttgttttaataccaactagaaaaatcatgaatcatatgttgttttactatgtatagatcatgaatgaaaatgtgtcgcatttgt |
43622158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University