View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_high_43 (Length: 231)
Name: NF6579_high_43
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_high_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 42 - 218
Target Start/End: Complemental strand, 40119770 - 40119590
Alignment:
| Q |
42 |
caagtatggtattgagtggcgtagttcagtttcttggctgaggggtttggtttttgtgt--agtgatcgattgtgttaattacgctgaaatgatagcgat |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40119770 |
caagtatggtattgagtggcgtagttcagtttcttggctgaggggtttggtttttgtgtgtagtgatcgattgtgttaattacgctgaaatgatagcgat |
40119671 |
T |
|
| Q |
140 |
catgttaatgtttattactactatgctttttcagaattggtggcacgttacgctgtttacag--atattgtatgatttatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
40119670 |
catgttaatgtttattactactatgctttttcagaattggtggcacgttacgccgtttacagatatattgtatgatttatg |
40119590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University