View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_21 (Length: 354)
Name: NF6579_low_21
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 4217574 - 4217909
Alignment:
| Q |
1 |
atatttctgataatttggaaagcaagaagtgcaatgattttcaatcaagaaggattcaannnnnnnnctgtttacctgcattattttgcaggtcatatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4217574 |
atatttctgataatttggaaagcaagaagtgcaatgattttcaatcaagaaggattcaattttttt-ctgtttacctgcattattttgcaggtcatatga |
4217672 |
T |
|
| Q |
101 |
tatgttgcattggggttattcgattagatctgtgggttagctaggaagttgtgttggtgttgaattgtatcagtttttattatggtattttgtgtgggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4217673 |
tatgttgcattggggttattcgattagatctgtgggttagctaggaagttgtgttggtgttgaattgtatcagtttttattgtggtattttgtgtgggag |
4217772 |
T |
|
| Q |
201 |
attttagtcaattttggtttttactgcttcctggcgcccgtgttttttagttagctaggccttgtttagaagcattgtttgtatttttgtattcttgcaa |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4217773 |
attttagtcaattttggtttttattgcttcctggtgcccgtgttttttagttagttaagccttgtttagaagcattgtttgtatttttgtattcttgcag |
4217872 |
T |
|
| Q |
301 |
atcttgtgctcgatcatttataatattagctcttttt |
337 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4217873 |
atcttgtgcttgatcatttataatattagctcttttt |
4217909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 259 - 331
Target Start/End: Complemental strand, 5939620 - 5939547
Alignment:
| Q |
259 |
gccttgtttagaagcattgtttgtatttttgt-attcttgcaaatcttgtgctcgatcatttataatattagct |
331 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | | ||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
5939620 |
gccttgtttagaagtattgtttgtattttttttactcttgcagatcttgtgcttgatcatttataatattagct |
5939547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University