View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_26 (Length: 318)
Name: NF6579_low_26
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_26 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 154 - 318
Target Start/End: Original strand, 1592709 - 1592882
Alignment:
| Q |
154 |
ttcctttcgcgcagcccgacggcaaaattttcattatgattgg--att-----aatcaggactacacgtttagttattgcctttcatttaactttcttct |
246 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||| | ||||||||||||| |||||||| ||||||||| |||||||||| |
|
|
| T |
1592709 |
ttcctttcgcgcagcccgacggtgaaattttcattatgattggtgattggtatactcaggactacacggttagttatcacctttcattagactttcttct |
1592808 |
T |
 |
| Q |
247 |
ataaattttgaaaatgttgtg--tttttattgatatttaattgctattttgtatgtttgtttgataaatatagg |
318 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1592809 |
gtaaattctgaagatgttgtgagtttttattgatatttgattgctattttgtatgtttttttgataaatatagg |
1592882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 266 - 318
Target Start/End: Complemental strand, 6097967 - 6097915
Alignment:
| Q |
266 |
tgtttttattgatatttaattgctattttgtatgtttgtttgataaatatagg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6097967 |
tgtttttattgatatttaattgctattttgtatgtttgtttgataaatatagg |
6097915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University