View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_33 (Length: 289)
Name: NF6579_low_33
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 153 - 279
Target Start/End: Original strand, 28629045 - 28629173
Alignment:
| Q |
153 |
actgcagctacatgatccttattaatagtgacatgttgggaaatttggaggaataggaatgaggagatatttcaaaataaataaactcaagtaggc--gg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
28629045 |
actgcagctacatgatccttattaatagtgacatgttgggaaatttggaggaataggaatgaggagatatttcaaaataaataaactcacgtaggcgggg |
28629144 |
T |
 |
| Q |
251 |
atgctaatgacattttcttcatctcactc |
279 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
28629145 |
atgctaatgacattttcttcatttcactc |
28629173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 22 - 127
Target Start/End: Original strand, 28628856 - 28628961
Alignment:
| Q |
22 |
acacttcaaggtcaaaagtcaacccaaaagaaacattgtt-attggctttgttatacatgatttccttccaactaatgaatcacttcagaaacttccgtc |
120 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28628856 |
acacttcaaggtcacaagtcaactcaaatgaaacattgtttattggctt-gttatacatgatttccttccaactgatgaatcacttcagaaacttccgtc |
28628954 |
T |
 |
| Q |
121 |
atcttac |
127 |
Q |
| |
|
||||||| |
|
|
| T |
28628955 |
atcttac |
28628961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 230
Target Start/End: Original strand, 29837179 - 29837229
Alignment:
| Q |
180 |
gtgacatgttgggaaatttggaggaataggaatgaggagatatttcaaaat |
230 |
Q |
| |
|
|||| ||||||||| ||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
29837179 |
gtgatatgttgggagatttggaagaacagaaatgaggagatatttcaaaat |
29837229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University