View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_34 (Length: 288)
Name: NF6579_low_34
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 5972867 - 5972613
Alignment:
| Q |
1 |
tttgaagaatgtgatgtgatgatgcgtgggaggaacgagtaaggggagtgttnnnnnnnnnnnn----agagcgggattgatggaaaacggtgatgtaga |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
5972867 |
tttgaagaatgtgatgtgatgatgcgtgggaggaacgagtaaggggagtgtttgtgtgtgtgtgtgtgagagcgggattgatggaaaacggtgatgcaga |
5972768 |
T |
 |
| Q |
97 |
ggagagggaaagtgaggagagagaaatagctgttggaaaaggacaaaacttttcccatgttataagaaacactacacatgacaaatatgcccctaatcta |
196 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5972767 |
ggaaag---------------agaaatagctgttggaaaaggacaaaacttttcccatgttataagaaacactacacatgacaaatatgcccctaatcta |
5972683 |
T |
 |
| Q |
197 |
acttttagtacccttattacccccttattaaatacattatgtgcttcttttatcatagcgttacacaagc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5972682 |
acttttagtacccttattacccccttattaaatacattatgtgcttcttttatcatagcgttacacaagc |
5972613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University