View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_35 (Length: 288)
Name: NF6579_low_35
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 36 - 271
Target Start/End: Complemental strand, 41244770 - 41244535
Alignment:
| Q |
36 |
acttattgtttcaaaacatatctaacttttactcgttcttcatcttataaagtaactaaataaatcataaaatttatcacgttttcttccatcaatttag |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41244770 |
acttattgtttcaaaacatatctaacttttactcgttcttcatcttataaagtaactaaataaatcataaaatttatcacgttttcttccatcaatttag |
41244671 |
T |
 |
| Q |
136 |
atccactaccaatggaaaatattttccacttttccgcgattatttatattgacgtttgtaggttgtgataatgttagttgcttcatttaattatcgtatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41244670 |
atccactaccaatggaaaatattttccacttttccgcgattatttatattgacgtttgtaggttgtgataatgtttgttgcttcatttaattatcgtatt |
41244571 |
T |
 |
| Q |
236 |
tacttgcttatatttatatgcacatacgtctggact |
271 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
41244570 |
tacttgcttatatttatatgcacgtacgtcgggact |
41244535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 246
Target Start/End: Complemental strand, 41231843 - 41231798
Alignment:
| Q |
201 |
tgataatgttagttgcttcatttaattatcgtatttacttgcttat |
246 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
41231843 |
tgataatgttagttgcttcatttagttatcatatttacttgcttat |
41231798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University