View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_38 (Length: 259)
Name: NF6579_low_38
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 6097914 - 6097751
Alignment:
| Q |
1 |
ctctaagatcaacacttgatggtggaaaagccttggaata---ccagattgtgttcttatcaatgggaagggaccttatcagtacaataatactcttgtc |
97 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6097914 |
ctctaagatcaacatttgatggtggaaaagccttggaatagtaccagattgtgttcttatcaatgggaag--accttatcagtacaataatactcttgtc |
6097817 |
T |
|
| Q |
98 |
ccaaataatgaaaagctataaaacactgacgcaataccaatgcctacacacagtgtacaccacacc |
163 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6097816 |
ccaaataatgaaaagctatgaaacactgacgcaataccaatgcctacacacaatgtacaccacacc |
6097751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 1592883 - 1592979
Alignment:
| Q |
1 |
ctctaagatcaacacttgatggtggaaaag-ccttggaataccagattgtgttcttatcaatgggaagggaccttatcagtacaataatactcttgt |
96 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1592883 |
ctctaagatcaacacttgacggtggaaaagaccttggaataccagatggtgttcttatcaatgggaagggaccttatcagtacaataatactcttgt |
1592979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 129 - 243
Target Start/End: Original strand, 1593132 - 1593245
Alignment:
| Q |
129 |
caataccaatgcctacacacagtgtacaccacacccactttcaatttttacactggtctattggtttgagttttgactggnnnnnnnactcaatctctgc |
228 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||| ||||||| ||||||||||| || ||||||| | ||| ||||||| |
|
|
| T |
1593132 |
caataccaatgcctacacacaatgtaaaccacacccactttcaatttttccactggtttattggtttgacttgtgactggttctttca-tcactctctgc |
1593230 |
T |
|
| Q |
229 |
aaagtaatttgtttt |
243 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1593231 |
aaagtaatttgtttt |
1593245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University