View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_50 (Length: 228)
Name: NF6579_low_50
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 190
Target Start/End: Complemental strand, 35518768 - 35518582
Alignment:
| Q |
12 |
agataattctacgactatattgaggatttatagtgaaatttacgtatatacaaatttttagatcatgacgaacaatgatctgatattttttaactttgtc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35518768 |
agataattctacgactatattgaggatttatagtgaaatttacatatatacaagtttttagatcatgatgaacaatgatctgatattttttaactttgtc |
35518669 |
T |
|
| Q |
112 |
tagcttttttgaaaatccaccctacttattcttggggattgaactccaagagca--------aagagttcataacgtgtttttagat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35518668 |
tagcttttttgaaaatccaccctacttattcttggcgattgaactccaagagcaactttagtaagagttcataacgtgtttttagat |
35518582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University