View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6579_low_51 (Length: 226)
Name: NF6579_low_51
Description: NF6579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6579_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 36 - 209
Target Start/End: Original strand, 50731931 - 50732104
Alignment:
| Q |
36 |
gaataatcatggaagagttggtccatggcctgaaagcactcattagaccatcgaaattgtttaaaatcacaaacttgttttgctttctcatattgctcat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50731931 |
gaataatcatggaagagttggtccatggcctgaaagcactcattagaccatcgaaattgtttaaaatcacaaacttgttttgctttctcatattgctcat |
50732030 |
T |
|
| Q |
136 |
ctgatattactgcatgactccatgcatattctacaatgcctttataatcatagtaatcatcagtttctggattc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50732031 |
ctgatattactgcatgactccatgcatattctacaatgcctttataatcatagtaatcatcagtttctggattc |
50732104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 71 - 209
Target Start/End: Original strand, 50724665 - 50724803
Alignment:
| Q |
71 |
gcactcattagaccatcgaaattgtttaaaatcacaaacttgttttgctttctcatattgctcatctgatattactgcatgactccatgcatattctaca |
170 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
50724665 |
gcactcattagaccattgagattgtttgaaatcacaaacttgttttgctttctcatattgctgatctgatatcactgcatgactccatgcatattctaga |
50724764 |
T |
|
| Q |
171 |
atgcctttataatcatagtaatcatcagtttctggattc |
209 |
Q |
| |
|
| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
50724765 |
aggcctttattgtcatagtaatcttcagtttctggattc |
50724803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University