View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6580_low_7 (Length: 298)
Name: NF6580_low_7
Description: NF6580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6580_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 145
Target Start/End: Original strand, 1083356 - 1083500
Alignment:
| Q |
1 |
aaactgaagacactactcaacaaagggacggttttgcttctggaggttagtatcttattttcttcctttaaattaaaaattcactttttatgaacaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1083356 |
aaactgaagacactactcaacaaagggacggttttgcttctggaggttagtatcttattttcttcctttaaattaaaaattcactttttatgaacaaaat |
1083455 |
T |
 |
| Q |
101 |
caaaggaaccaagatgcaaatgcaaaagggttgtgttgtgtataa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1083456 |
caaaggaaccaagatgcaaatgcaaaagggttgtgttgtgtataa |
1083500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University