View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6580_low_8 (Length: 284)
Name: NF6580_low_8
Description: NF6580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6580_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 157 - 266
Target Start/End: Original strand, 38048451 - 38048572
Alignment:
| Q |
157 |
caaagcattcaatgtgattcgaccatgtaaatatgttataatattattttata------------cacgattaataaaatagttaaatatatgtcatgca |
244 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38048451 |
caaagcattcaatgtgattcgaccatttaaatatgttataatattattttataaaatagtacatacacgattaataaaatagttaattatatgtcatgca |
38048550 |
T |
|
| Q |
245 |
cgttgaattcatatttatctct |
266 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38048551 |
cgttgaattcatatttatctct |
38048572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 38048310 - 38048373
Alignment:
| Q |
13 |
gataatactatggatcacatatactatatatatagataagaaaataaagcgaactagaaaacatac |
78 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38048310 |
gataatactatggatcgcatatactata--tatagataagaaaataaagcgaactagaaaacatac |
38048373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University