View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6581_high_24 (Length: 258)
Name: NF6581_high_24
Description: NF6581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6581_high_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 13 - 258
Target Start/End: Original strand, 41044534 - 41044779
Alignment:
| Q |
13 |
aatatagaaaaaagtggagaaatgagttagcgttatgatgtgtatacataaaacaatggcctaagccatgccaaaactagagatccatgagatattattt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41044534 |
aatatagaaaaaagtggagaaatgagttagagttatgatgtgtatacatagaacaatggcctaagccatgccaaaactagagatccatgagatattattt |
41044633 |
T |
 |
| Q |
113 |
tatttgattatgtatatataactccatttataaaggagacaaactttatctgcttacggtaaagaatcaaatatactggtattggtctctattcagtatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41044634 |
tatttgattatgtatatataactccatttataaaggagacaaactttatctgcttacggtaaagaatcaaatatactggtattggtctctattcagtatt |
41044733 |
T |
 |
| Q |
213 |
tgcaacttctatccttgaaacatctacaaaagctcaccattatcat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41044734 |
tgcaacttctatccttgaaacatctacaaaagctcaccattatcat |
41044779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University