View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6581_low_17 (Length: 338)
Name: NF6581_low_17
Description: NF6581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6581_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 202 - 327
Target Start/End: Original strand, 35556256 - 35556381
Alignment:
| Q |
202 |
atcttccgatttttggaacacataccctctctgagttgtggttcactgataaaatgcatatctatagagggagacttgtaattacaaagaaaaaacccct |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35556256 |
atcttccgatttttggaacacataccctctctgagttgtggttcactgataaaatgcatatctatagagggagacttgtaattacaaagaaaaaacccct |
35556355 |
T |
 |
| Q |
302 |
acacaaccattacgcctattattcat |
327 |
Q |
| |
|
||||||||||||| |||||||||||| |
|
|
| T |
35556356 |
acacaaccattacacctattattcat |
35556381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 139
Target Start/End: Original strand, 35556074 - 35556193
Alignment:
| Q |
19 |
aaagaatacaccaacgcgaattgtaatataatccaatctaatatcttagggaaagatgagattgaaggaagatatgaacttttatttgtacgtttgatat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35556074 |
aaagaatacaccaacgcgaattgtaatataatccaatctaatatcttagggaaagatgagattg-aggaagatatgaacttttatttgtacgtttgatat |
35556172 |
T |
 |
| Q |
119 |
ctctaatttaagttatatgtg |
139 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35556173 |
ctctaatttaagttatatgtg |
35556193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University