View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6581_low_2 (Length: 616)
Name: NF6581_low_2
Description: NF6581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6581_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 8e-75; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 8e-75
Query Start/End: Original strand, 342 - 529
Target Start/End: Complemental strand, 19449691 - 19449506
Alignment:
| Q |
342 |
atagctaggctaattggtcatggaccaatgaataaattggagctctagttaagcctataaagcttagtggaatatccaaat-tctctagaattgtattgt |
440 |
Q |
| |
|
|||| ||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19449691 |
atagttaggctaattgatcttcgaccaatgaataaattggagctctagttaagcctataaagcttagtggaatatccaaagctctctagaattgtattgt |
19449592 |
T |
 |
| Q |
441 |
ttttctccttcttatttttacaaagccaaaagtcccacataggtcaaatttgtgtgtttattagtctttatatactaatatgtaattta |
529 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19449591 |
ttttctcctt---atttttacaaagccaaaagtcccacataggtcaaatttgtgtgtttattagtctttatatactaatgtgtaattta |
19449506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 163 - 245
Target Start/End: Complemental strand, 19441771 - 19441689
Alignment:
| Q |
163 |
ttggttaaaccctgcactcaaattgtgcagataccataaactaagatccacatgtagtggaataacatgaacataatgaagca |
245 |
Q |
| |
|
|||||||||| ||||||| || || || |||||||||||||||| ||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
19441771 |
ttggttaaactctgcactgaagttctgtagataccataaactaaaatccacaggtagtggaatatcatgaacaaaatgaagca |
19441689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University