View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6581_low_30 (Length: 226)
Name: NF6581_low_30
Description: NF6581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6581_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 12571345 - 12571556
Alignment:
| Q |
1 |
ataatgaggggcttgagttggagataatgaaaattgctgaggattggataaatgagtcatttgaaaaagcttatgatattgtgcatgttaataaagatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12571345 |
ataatgaggggcttgagttggagataatgaaaattgctgaggattggataaatgagtcatttgaaaaagcttatgatattgtgcatgttaataaagatgc |
12571444 |
T |
|
| Q |
101 |
ttatatcaaggagatggataggagaggtggatggagtaggtttgttgaggagcaagatgagttggttatggagattgaggcagctatattccatagtttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
12571445 |
ttatatcaaggagatggataggagaggtggatggagtaggtttgatgaggagcaagatgagttggttatggagattgaggcagctatattacaaagtttg |
12571544 |
T |
|
| Q |
201 |
attgatgatatt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12571545 |
attgatgatatt |
12571556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University