View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6581_low_32 (Length: 210)
Name: NF6581_low_32
Description: NF6581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6581_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 17 - 174
Target Start/End: Original strand, 49082661 - 49082812
Alignment:
| Q |
17 |
tcagttagcactgtattcaaattcatgctcaacggggctgtcgattttctcattaaaccagttcgcaggaatgagcttaggaacctgtggcagcatgtgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49082661 |
tcagttagcactgtattcaaattcatgctcaacggggctgtcgattttctcattaaaccagttcgcaggaatgagcttaggaacttgtggcagcatgtgt |
49082760 |
T |
|
| Q |
117 |
ggagaagaaatactactgtatgtcaatgtcaatatacttacttatattccaatccaac |
174 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
49082761 |
ggagaagaaatactactgt------atgtcaatatacttatttatattccaatccaac |
49082812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University