View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6582_high_4 (Length: 376)
Name: NF6582_high_4
Description: NF6582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6582_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 32474052 - 32473875
Alignment:
| Q |
16 |
aaggggagagatacgaaacagttgtctatgtttcccaccgcttcaactgtgaactccatcgttacaatggaaaattgagaactcagttcagtgaattgac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32474052 |
aaggggagagatacgaaacagttgtctatgtttcccaccgcttcaactgtgaactccatcgttacaatggaaaattgagaactcagttcagtgaattgac |
32473953 |
T |
 |
| Q |
116 |
catacacgcacacgactgtggaagtaacgattgcggtaggcaacactcaggaaagattattttgatggaataaatttacatt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
32473952 |
cata----cacacgactgtggaagtaacgattgcggtaggcaacactcaggaaatattattttgatggaataaattaacatt |
32473875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 290 - 330
Target Start/End: Complemental strand, 32473773 - 32473733
Alignment:
| Q |
290 |
catacaaaattacttgtcttgtaaatttcttcttttactta |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32473773 |
catacaaaattacttgtcttgtaaatttcttctattactta |
32473733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University