View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6582_high_9 (Length: 242)
Name: NF6582_high_9
Description: NF6582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6582_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 28241949 - 28241746
Alignment:
| Q |
10 |
aagttcttactcttttacttaacaaaaggttggattctttcaattttttacttttaactttgtgctattagtgaacccttatccaatgtgtgttaaaata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
28241949 |
aagttcttactcttttacttaacaaaaggttggattctttcaattttttacttt-aactttgtgctattagtgaacccttatctaatgtgtgttaaaata |
28241851 |
T |
 |
| Q |
110 |
tttgctcgcaaggtgtgccgcaagggatacattttggttactgcagatggcaggggtcaatcaacaaagggtaactataagtattctttgcgagactgct |
209 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28241850 |
tttgctcgc------------aagggatacattttggttactgcagatggcaggggtcaatcaacaaagggtaactataagtattctttgcgagactgct |
28241763 |
T |
 |
| Q |
210 |
atttctattgaaatctg |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
28241762 |
atttctattgaaatctg |
28241746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 309041 - 309130
Alignment:
| Q |
1 |
gctgagaggaagttcttactcttttacttaacaaaaggttggattctttcaatttttt--acttttaactttgtgctattagtgaacccttat |
91 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
309041 |
gctgagaggaagttcttactcttttactcaacaaaaggttggattctttcaattttttttactt---actttgtgctattagtgaacccttat |
309130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 130 - 222
Target Start/End: Complemental strand, 2370385 - 2370294
Alignment:
| Q |
130 |
caagggatacattttggttactgcagatggcaggggtcaatcaacaaagggtaactataagtattctttgcgagactgctatttctattgaaa |
222 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||| |||||||||| || ||||||| |
|
|
| T |
2370385 |
caagggatacattttggttactgcaaatggcagga-tcaatcaacaaaggataactataagtattctttgccagactgctatgtccattgaaa |
2370294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 55437970 - 55438034
Alignment:
| Q |
134 |
ggatacattttggttactgcagatggcaggggtcaatcaacaaagggtaactataagtattctttg |
199 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||||||||||| ||||| || ||||||||||||| |
|
|
| T |
55437970 |
ggatacattttggttactgcaaatgg-tgggatcaatcaacaacgggtagctgtaagtattctttg |
55438034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University