View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6583_high_10 (Length: 227)
Name: NF6583_high_10
Description: NF6583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6583_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 53689067 - 53689239
Alignment:
| Q |
1 |
atgtgggtgccgcacctggaattcctccgtccctaatggagaatactaggcactggcgtaccgcatcatctctattgtaataatttcttttacttgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53689067 |
atgtgggtgccgcacctggaattcctccgtccctaatggagaatactaggcactggcgtaccacatcatctctattgtaataatttcttttacttgcaga |
53689166 |
T |
 |
| Q |
101 |
aaaagaagtcccttcaaacttattcggtatttcttttttaattgaaattaggaaaggagattgaaaacataat |
173 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53689167 |
aaaagaagtcccttcaaacttattcagtatttcttttttaattgaaattaggaaaggagattgaaaacttaat |
53689239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 173 - 214
Target Start/End: Original strand, 53693258 - 53693299
Alignment:
| Q |
173 |
taataatctaaacatagctaattgaaatatactagtataatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53693258 |
taataatctaaacatagctaattgaaatatactagtgtaatc |
53693299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University