View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6583_high_11 (Length: 227)

Name: NF6583_high_11
Description: NF6583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6583_high_11
NF6583_high_11
[»] chr7 (2 HSPs)
chr7 (67-210)||(24860955-24861097)
chr7 (1-68)||(24862370-24862437)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 67 - 210
Target Start/End: Complemental strand, 24861097 - 24860955
Alignment:
67 gttgttgttggtggggaggacctctgaggacaatctttgagagcgggtcttagggaccttaatctctcgagagtgtcattccttgtccttctgcaggatt 166  Q
    |||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
24861097 gttgctgttggtggg-aggacctctaaggacaatctttgagagcgggtcttagggaccttaatttttcgagagtgtcattccttgtccttctgcaggatt 24860999  T
167 gtgtaggccttgggcggtggctctgggatgcatggacaactttc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
24860998 gtgtaggccttgggcggtggctctgggatgcatggacaactttc 24860955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 24862437 - 24862370
Alignment:
1 atagtcaaatttaggtaagggtataattgggaggagaaaagggaagttcaaaaccgtatactttctgt 68  Q
    |||||||||||||||||||||| | |||| |||||||||| ||||||||||||| |||||||||||||    
24862437 atagtcaaatttaggtaagggtgtgattgtgaggagaaaaaggaagttcaaaacggtatactttctgt 24862370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University