View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6583_low_12 (Length: 227)
Name: NF6583_low_12
Description: NF6583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6583_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 67 - 210
Target Start/End: Complemental strand, 24861097 - 24860955
Alignment:
| Q |
67 |
gttgttgttggtggggaggacctctgaggacaatctttgagagcgggtcttagggaccttaatctctcgagagtgtcattccttgtccttctgcaggatt |
166 |
Q |
| |
|
|||| |||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
24861097 |
gttgctgttggtggg-aggacctctaaggacaatctttgagagcgggtcttagggaccttaatttttcgagagtgtcattccttgtccttctgcaggatt |
24860999 |
T |
 |
| Q |
167 |
gtgtaggccttgggcggtggctctgggatgcatggacaactttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24860998 |
gtgtaggccttgggcggtggctctgggatgcatggacaactttc |
24860955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 24862437 - 24862370
Alignment:
| Q |
1 |
atagtcaaatttaggtaagggtataattgggaggagaaaagggaagttcaaaaccgtatactttctgt |
68 |
Q |
| |
|
|||||||||||||||||||||| | |||| |||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
24862437 |
atagtcaaatttaggtaagggtgtgattgtgaggagaaaaaggaagttcaaaacggtatactttctgt |
24862370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University