View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6583_low_9 (Length: 267)
Name: NF6583_low_9
Description: NF6583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6583_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 11 - 210
Target Start/End: Original strand, 5160090 - 5160289
Alignment:
| Q |
11 |
ataatatgggatgttgttgttgatccttcgtttcaagggcttggtctagggaaagctgttgtggagaggcttatgaaggatcttgtaggaaaagggatta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
5160090 |
ataatatgggatgttgttgttgatccttcgtttcaagggcttgggctagggaaagctgttgtggagaggcttatgagggatcttgtaggaagagggatta |
5160189 |
T |
 |
| Q |
111 |
ccaatatttctctttattctgagccaagagttcttggcttttatcgacctttgggttttgttgctgatcctgatggtattcgtggaatggtttactctac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5160190 |
ccaatatttctctttattctgagccaagagttcttggcttttatcgacctttgggttttgttgctgatcctgatggtattcgtggaatggtttactctac |
5160289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University