View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6584_low_5 (Length: 248)
Name: NF6584_low_5
Description: NF6584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6584_low_5 |
 | |
|
| [»] scaffold0026 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 9 - 173
Target Start/End: Complemental strand, 22674503 - 22674341
Alignment:
| Q |
9 |
catcatcacaaatctttgatttgtcataactttgcgtgtatagttaaatgatatgattatacaatattcaactatgaactcatcaaatcttctnnnnnnn |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22674503 |
catcatcacaaatctttgatttgtcataactttgtgtgtatagttaaatgatatgattatacaatattcaactatgaactcatcaaatcttct--aaaaa |
22674406 |
T |
|
| Q |
109 |
nnnngctatgaactcatcaaatctaatgtatatttaattatcaagtcaataattaaacaaatatg |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22674405 |
aaaagctatgaactcatcaaatctaatgtatatttaattatcaagtcaataattaaacaaatatg |
22674341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 199 - 248
Target Start/End: Complemental strand, 102761 - 102712
Alignment:
| Q |
199 |
taatgaaagtctaactagtagtagaatgttagtattaactaaaaatgctc |
248 |
Q |
| |
|
|||||||||| ||| ||||||||| |||||||||||| || ||||||||| |
|
|
| T |
102761 |
taatgaaagtttaattagtagtagtatgttagtattacctcaaaatgctc |
102712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University