View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6585_low_5 (Length: 226)
Name: NF6585_low_5
Description: NF6585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6585_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 15 - 206
Target Start/End: Original strand, 32265516 - 32265707
Alignment:
| Q |
15 |
agcataggaggttgcaattggctcattgcctatggtctgaaacagatataaaccatgttagagagagtgcaaccattgttgcaaagctggttggtacagt |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265516 |
agcataggaggttgcaattggctcatcgcctatggtctgaaacagatataaaccatgttagagagagtgcaaccattgttgcaaagctggttggtacagt |
32265615 |
T |
 |
| Q |
115 |
tgagcctgatcaggctttcaaggagatgtttggcctcaactttgcaccacgacgcagaagaaagaagtcgttcggttggacgtccagtatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32265616 |
tgagcctgatcaggctttcaaggagatgtttggcctcaactttgcaccacgacgcagaagaaagaagtcgttcggttggacgtccagtatga |
32265707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University