View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6588_low_10 (Length: 244)
Name: NF6588_low_10
Description: NF6588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6588_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 5 - 119
Target Start/End: Complemental strand, 50443075 - 50442962
Alignment:
| Q |
5 |
tgctttgtttgaaataaaattatgatgtttnnnnnnnnnnntgtgtgcatgggagtggagggtaacaggatgaattaattgattaattttcatttttcag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||| | |
|
|
| T |
50443075 |
tgctttgtttgaaataaaattatgatgtttaaaaaaaaaa-tgtgtgcatgggagtggagggtaagaggattaattaattgattacttttcatttttctg |
50442977 |
T |
|
| Q |
105 |
gatttttctggataa |
119 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
50442976 |
gatttttctggataa |
50442962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 46 - 107
Target Start/End: Original strand, 18198233 - 18198294
Alignment:
| Q |
46 |
tgtgtgcatgggagtggagggtaacaggatgaattaattgattaattttcatttttcaggat |
107 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18198233 |
tgtgtgcatgggagtggagggtaagaggatgaattaattgattaattttcatttttctggat |
18198294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University