View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6588_low_10 (Length: 244)

Name: NF6588_low_10
Description: NF6588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6588_low_10
NF6588_low_10
[»] chr1 (1 HSPs)
chr1 (5-119)||(50442962-50443075)
[»] chr3 (1 HSPs)
chr3 (46-107)||(18198233-18198294)


Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 5 - 119
Target Start/End: Complemental strand, 50443075 - 50442962
Alignment:
5 tgctttgtttgaaataaaattatgatgtttnnnnnnnnnnntgtgtgcatgggagtggagggtaacaggatgaattaattgattaattttcatttttcag 104  Q
    ||||||||||||||||||||||||||||||           |||||||||||||||||||||||| ||||| ||||||||||||| |||||||||||| |    
50443075 tgctttgtttgaaataaaattatgatgtttaaaaaaaaaa-tgtgtgcatgggagtggagggtaagaggattaattaattgattacttttcatttttctg 50442977  T
105 gatttttctggataa 119  Q
    |||||||||||||||    
50442976 gatttttctggataa 50442962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 46 - 107
Target Start/End: Original strand, 18198233 - 18198294
Alignment:
46 tgtgtgcatgggagtggagggtaacaggatgaattaattgattaattttcatttttcaggat 107  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
18198233 tgtgtgcatgggagtggagggtaagaggatgaattaattgattaattttcatttttctggat 18198294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University